Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000010
Genome
Vibrio parahaemolyticus - NC_004603.1
TF
LexA [UniProtKB:Q87KN2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTACTGGATATACTCACAGTTA - [3150342, 3150363] 22305460 Experimental technique details Comparative genomics search (ECO:0005622) - Experimental technique details EMSA (ECO:0001807) - 1

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VP2945 VP2946
Gene Locus tag Description
VP2945 VP2945 LexA repressor
VP2946 VP2946 hypothetical protein