Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000030
Genome
Vibrio parahaemolyticus - NC_004603.1
TF
LexA [UniProtKB:Q87KN2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATACTGTTGATTCATACAGTGT + [2694442, 2694463] 22305460 Experimental technique details Comparative genomics search (ECO:0005622) - Experimental technique details EMSA (ECO:0001807) - 1

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... recA VP2551
Gene Locus tag Description
recA VP2550 recombinase A
VP2551 VP2551 CinA-like protein