Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000050
Genome
Vibrio parahaemolyticus - NC_004603.1
TF
LexA [UniProtKB:Q87KN2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAACTGTATAAATGAACAGTAA + [2260932, 2260953] 22305460 Experimental technique details Comparative genomics search (ECO:0005622) - Experimental technique details EMSA (ECO:0001807) - 1

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VP2149 VP2147 VP2148 VP2146 VP2150
Gene Locus tag Description
VP2149 VP2149 DNA topoisomerase III
VP2147 VP2147 hypothetical protein
VP2148 VP2148 hypothetical protein
VP2146 VP2146 oxidoreductase
VP2150 VP2150 nitroreductase