Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000070
Genome
Vibrio parahaemolyticus - NC_004603.1
TF
LexA [UniProtKB:Q87KN2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GGGCTGGATGAATAAACAGGGG + [535830, 535851] 22305460 Experimental technique details Comparative genomics search (ECO:0005622) - Experimental technique details EMSA (ECO:0001807) - 1

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VP0518 VP0517 VP0519
Gene Locus tag Description
VP0518 VP0518 DNA mismatch repair protein
VP0517 VP0517 hypothetical protein
VP0519 VP0519 hypothetical protein