Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000000a0
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAGATGATAATGAATCTCAAA + [89954, 89974] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC0091 VC0090 VC0092
Gene Locus tag Description
VC0091 VC0091 O-methyltransferase-like protein
VC0090 VC0090 DNA-damage-inducible protein F
VC0092 VC0092 LexA repressor