Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000000c0
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CAAATGATAGTAATTTTCATT + [294066, 294086] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC0284 VC0283 VC0285 VC0286
Gene Locus tag Description
VC0284 VC0284
VC0283 VC0283 hypothetical protein
VC0285 VC0285 keto-hydroxyglutarate-aldolase/keto-deoxy-phosphogluconate aldolase
VC0286 VC0286 gluconate permease