Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000000d0
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GTAATGATAACCTTTATCAAT - [638890, 638910] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC0608 VC0607 VC0606 VC0609 VC0610
Gene Locus tag Description
VC0608 VC0608 iron(III) ABC transporter periplasmic iron-compound-binding protein
VC0607 VC0607
VC0606 VC0606 nitrogen regulatory protein P-II
VC0609 VC0609 iron(III) ABC transporter permease
VC0610 VC0610 iron(III) ABC transporter ATP-binding protein