Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000000f0
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTAATAAAAACTATTCTCATT - [830080, 830100] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC0773 VC0774 VC0772 VC0775
Gene Locus tag Description
VC0773 VC0773 vibriobactin-specific isochorismate synthase
VC0774 VC0774 2,3-dihydroxybenzoate-2,3-dehydrogenase
VC0772 VC0772 vibriobactin-specific 2,3-dihydroxybenzoate-AMP ligase
VC0775 VC0775 vibriobactin synthesis protein