Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000100
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CAAATGATAATAATTTGCAAT + [1337806, 1337826] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC1264 ribA VC1265 VC1266 VC1267
Gene Locus tag Description
VC1264 VC1264 iron-regulated protein A
ribA VC1263 GTP cyclohydrolase II
VC1265 VC1265 hypothetical protein
VC1266 VC1266 hypothetical protein
VC1267 VC1267 hypothetical protein