Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000110
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATAATGAGAGCGTTTCTCAAT - [1660977, 1660997] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC1548 VC1547 VC1546 VC1545 VC1544 VC1543 VC1549
Gene Locus tag Description
VC1548 VC1548 hypothetical protein
VC1547 VC1547 biopolymer transport protein ExbB-like protein
VC1546 VC1546 TonB system transport protein ExbB2
VC1545 VC1545 TonB system transport protein ExbD2
VC1544 VC1544 tonB2 protein
VC1543 VC1543 hypothetical protein
VC1549 VC1549 glycerol-3-phosphate ABC transporter periplasmic glycerol-3-phosphate-binding protein