Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000120
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AATGTGATAATAATTATCATT + [1684082, 1684102] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC1572 VC1571 VC1570 VC1569 VC1568 VC1567 VC1566 VC1565 VC1564 VC1563 fumC
Gene Locus tag Description
VC1572 VC1572 hypothetical protein
VC1571 VC1571 quinol oxidase subunit I
VC1570 VC1570 quinol oxidase subunit II
VC1569 VC1569 hypothetical protein
VC1568 VC1568 ABC transporter ATP-binding protein
VC1567 VC1567 hypothetical protein
VC1566 VC1566 hypothetical protein
VC1565 VC1565 outer membrane protein TolC
VC1564 VC1564 hypothetical protein
VC1563 VC1563 hypothetical protein
fumC VC1573 fumarate hydratase