Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000130
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTGTCGATAATAATTCTCATT + [1821441, 1821461] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC1688 VC1687 VC1686 VC1685 VC1684 VC1683 VC1682 VC1681 VC1680 VC1689
Gene Locus tag Description
VC1688 VC1688 hypothetical protein
VC1687 VC1687 manganese-dependent inorganic pyrophosphatase
VC1686 VC1686 hypothetical protein
VC1685 VC1685 hypothetical protein
VC1684 VC1684 peptide ABC transporter ATP-binding protein
VC1683 VC1683 peptide ABC transporter ATP-binding protein
VC1682 VC1682 peptide ABC transporter permease
VC1681 VC1681 peptide ABC transporter permease
VC1680 VC1680 peptide ABC transporter substrate-binding protein
VC1689 VC1689 hypothetical protein