Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000170
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTAATGATAATTAATATCATT - [2861931, 2861951] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC2694 cpxA VC2692
Gene Locus tag Description
VC2694 VC2694 superoxide dismutase, Mn
cpxA VC2693 two-component sensor protein
VC2692 VC2692 transcriptional regulator CpxR