Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000180
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AATCTGTAAGCCTTTCTCAAT - [974985, 975005] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC0913 VC0912 tRNA-Tyr-5 VC0914
Gene Locus tag Description
VC0913 VC0913 hypothetical protein
VC0912 VC0912 hypothetical protein
tRNA-Tyr-5 VCt054 tRNA
VC0914 VC0914 multidrug resistance protein