Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000190
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TAAATGAGAACGATTTTCTTG + [1310199, 1310219] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC1235 VC1236
Gene Locus tag Description
VC1235 VC1235 sodium/dicarboxylate symporter
VC1236 VC1236 PilB-like protein