Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000001b0
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AACTTGACCATCAATCTCTTT - [2484094, 2484114] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC2333 VC2332 VC2331 VC2330 VC2334 VC2335 VC2336
Gene Locus tag Description
VC2333 VC2333 ribosomal protein S6 modification protein-like protein
VC2332 VC2332 acetyltransferase
VC2331 VC2331 hypothetical protein
VC2330 VC2330 hypothetical protein
VC2334 VC2334 hypothetical protein
VC2335 VC2335 hypothetical protein
VC2336 VC2336 hypothetical protein