Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000001c0
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTCTCTAACATTGTTCTAAAT - [2240532, 2240552] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC2080 VC2079 VC2081
Gene Locus tag Description
VC2080 VC2080 AraC family transcriptional regulator
VC2079 VC2079 hypothetical protein
VC2081 VC2081 zinc ABC transporter periplasmic zinc-binding protein