Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000001f0
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CGTCAATGAGTTTTTCTCATT - [33107, 33127] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC0034 VC0033 VC0035 VC0036
Gene Locus tag Description
VC0034 VC0034 thiol:disulfide interchange protein
VC0033 VC0033 acyltransferase
VC0035 VC0035 serine/threonine protein kinase
VC0036 VC0036 FixG-like protein