Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000210
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGGGTGAGCAGGGTTCTCAAT + [2628113, 2628133] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... pyrG eno VC2449 mazG
Gene Locus tag Description
pyrG VC2448 CTP synthase
eno VC2447 phosphopyruvate hydratase
VC2449 VC2449 hypothetical protein
mazG VC2450 nucleoside triphosphate pyrophosphohydrolase