Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000220
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GCGCTAATAACCTTTCTCATC - [4347, 4367] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... rnpA VC0005 VC0004 rpmH
Gene Locus tag Description
rnpA VC0006 ribonuclease P
VC0005 VC0005 hypothetical protein
VC0004 VC0004 inner membrane protein translocase component YidC
rpmH VC0007 50S ribosomal protein L34