Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000230
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CGTCTGAGAATAATTCGTATT + [74751, 74771] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC0073 VC0072 VC0074
Gene Locus tag Description
VC0073 VC0073 hypothetical protein
VC0072 VC0072 sensory box/GGDEF family protein
VC0074 VC0074 hypothetical protein