Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000240
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAACGGGTAAATTATCTCTTG + [943827, 943847] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC0882 VC0881 VC0883 VC0884 VC0885 VC0886
Gene Locus tag Description
VC0882 VC0882 hypothetical protein
VC0881 VC0881 hypothetical protein
VC0883 VC0883 hypothetical protein
VC0884 VC0884 acetyltransferase-like protein
VC0885 VC0885 hypothetical protein
VC0886 VC0886 hypothetical protein