Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000250
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CGAGCGAAAGTCATTCTCATC - [997775, 997795] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC0931 VC0930 VC0932 VC0933
Gene Locus tag Description
VC0931 VC0931 hypothetical protein
VC0930 VC0930 hemolysin-like protein
VC0932 VC0932 hypothetical protein
VC0933 VC0933 hypothetical protein