Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000270
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TAACTGATAACGATTCTCATT + [2156708, 2156728] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... rrmA VC2002 VC2004
Gene Locus tag Description
rrmA VC2003 23S rRNA methyltransferase
VC2002 VC2002 hypothetical protein
VC2004 VC2004 hypothetical protein