Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000290
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATGTTGAGAGCTTATCCCATT + [2669147, 2669167] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC2489 VC2488 VC2487 VC2490
Gene Locus tag Description
VC2489 VC2489 TetR family transcriptional regulator
VC2488 VC2488 hypothetical protein
VC2487 VC2487 hypothetical protein
VC2490 VC2490 2-isopropylmalate synthase