Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000002a0
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GCGTAGTTCATCATTATCATT - [2683603, 2683623] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC2498 tRNA-Leu-10 VC2499 VC2500
Gene Locus tag Description
VC2498 VC2498 hypothetical protein
tRNA-Leu-10 VCt086 tRNA
VC2499 VC2499 hypothetical protein
VC2500 VC2500 hypothetical protein