Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000002b0
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAATTGTACCGTATTCTCATC - [2911738, 2911758] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC2738 VC2737 VC2739 VC2740
Gene Locus tag Description
VC2738 VC2738 phosphoenolpyruvate carboxykinase
VC2737 VC2737 hypothetical protein
VC2739 VC2739 hypothetical protein
VC2740 VC2740 hypothetical protein