Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000002c0
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATGACAGTCGGTATTATCATG - [49926, 49946] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC0052 VC0051 VC0053 VC0054 VC0055
Gene Locus tag Description
VC0052 VC0052 phosphoribosylaminoimidazole carboxylase catalytic subunit
VC0051 VC0051 phosphoribosylaminoimidazole carboxylase ATPase subunit
VC0053 VC0053 hypothetical protein
VC0054 VC0054 Sua5/YciO/YrdC family protein
VC0055 VC0055 coproporphyrinogen III oxidase