Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000002d0
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CAAATGATAACTGCTCTCAAT + [936877, 936897] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 2

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC0872 VC0871 VC0873 VC0874 VC0875
Gene Locus tag Description
VC0872 VC0872 hypothetical protein
VC0871 VC0871 hypothetical protein
VC0873 VC0873 hypothetical protein
VC0874 VC0874 hypothetical protein
VC0875 VC0875 prolyl-tRNA synthetase