Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000002e0
Genome
Vibrio cholerae - NC_002506.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CAAATGATAATTGATCTTATT + [68798, 68818] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 3

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCA0063 VCA0062 VCA0061 VCA0060 VCA0064 VCA0065 VCA0066 VCA0067
Gene Locus tag Description
VCA0063 VCA0063 protease II
VCA0062 VCA0062 hypothetical protein
VCA0061 VCA0061 DEAD/DEAH box helicase
VCA0060 VCA0060 hypothetical protein
VCA0064 VCA0064 TonB system receptor
VCA0065 VCA0065 hypothetical protein
VCA0066 VCA0066 hypothetical protein
VCA0067 VCA0067 hypothetical protein