Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000002f0
Genome
Vibrio cholerae - NC_002506.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CAAATGATAACGATTCGCATA - [253570, 253590] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 3

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCA0232 VCA0231 VCA0230 VCA0229 VCA0228
Gene Locus tag Description
VCA0232 VCA0232
VCA0231 VCA0231 AraC family transcriptional regulator
VCA0230 VCA0230 iron(III) ABC transporter ATP-binding protein
VCA0229 VCA0229 iron(III) ABC transporter permease
VCA0228 VCA0228 iron(III) ABC transporter permease