Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000300
Genome
Vibrio cholerae - NC_002506.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CAAATGATAGCAATTATCATT + [514883, 514903] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 3

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCA0576 VCA0575 VCA0574
Gene Locus tag Description
VCA0576 VCA0576 heme transport protein HutA
VCA0575 VCA0575 LysR family transcriptional regulator
VCA0574 VCA0574 hypothetical protein