Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000310
Genome
Vibrio cholerae - NC_002506.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CAATTGATAATTATTATCAAT + [562567, 562587] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 3

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCA0625 VCA0624 VCA0623 VCA0626
Gene Locus tag Description
VCA0625 VCA0625 TonB receptor-like protein
VCA0624 VCA0624 transketolase
VCA0623 VCA0623 transaldolase B
VCA0626 VCA0626 hypothetical protein