Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000360
Genome
Vibrio cholerae - NC_002506.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GAGACCGAATCTATTCTCAAT + [580825, 580845] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 3

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCA0645 VCA0646 VCA0647 VCA0648 VCA0649
Gene Locus tag Description
VCA0645 VCA0645 hypothetical protein
VCA0646 VCA0646 hemolysin
VCA0647 VCA0647 hypothetical protein
VCA0648 VCA0648 hypothetical protein
VCA0649 VCA0649 hypothetical protein