Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000370
Genome
Vibrio cholerae - NC_002506.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TACTCCTTCACTATTCTCAAT + [899530, 899550] 21750152 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 3

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCA0947 VCA0946 VCA0948
Gene Locus tag Description
VCA0947 VCA0947 spermidine n1-acetyltransferase
VCA0946 VCA0946 maltose/maltodextrin transporter ATP-binding protein
VCA0948 VCA0948 hypothetical protein