Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000003d0
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CCCTTGATAACGGATCTCAAA - [564605, 564625] 21750152 Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 5

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC0533 pcm surE truD ispF ispD ftsB VC0534
Gene Locus tag Description
VC0533 VC0533 lipoprotein NlpD
pcm VC0532 protein-L-isoaspartate O-methyltransferase
surE VC0531 stationary phase survival protein SurE
truD VC0530 tRNA pseudouridine synthase D
ispF VC0529 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase
ispD VC0528 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
ftsB VC0527 cell division protein FtsB
VC0534 VC0534 RNA polymerase sigma-38 factor