Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000003e0
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTCACATTCACGAATATCATT - [594564, 594584] 21750152 Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 5

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC0559 VC0560
Gene Locus tag Description
VC0559 VC0559 hypothetical protein
VC0560 VC0560 signal recognition particle protein