Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000003f0
Genome
Vibrio cholerae - NC_002505.1
TF
Fur [UniProtKB:P0C6C8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TAATTAATAATTATTCTCAAG - [940565, 940585] 21750152 Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - 5

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VC0877 VC0876 rpmE2 rpmJ
Gene Locus tag Description
VC0877 VC0877 hypothetical protein
VC0876 VC0876 hypothetical protein
rpmE2 VC0878 50S ribosomal protein L31
rpmJ VC0879 50S ribosomal protein L36