Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000a90
Genome
Salmonella enterica - NC_003197.1
TF
PhoP [UniProtKB:P0DM78, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTGTGTTTAGAGAGAATTTACAT - [1331613, 1331635] 20661307 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) - 13

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... pagD pagC STM1245
Gene Locus tag Description
pagD STM1244 virulence protein PAGD precursor
pagC STM1246 virulence membrane protein PAGC precursor
STM1245 STM1245 pseudo