Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000b00
Genome
Salmonella enterica - NC_003197.1
TF
PhoP [UniProtKB:P0DM78, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTTCGTTTAAGATTGGTTAATTA - [1520957, 1520979] 20661307 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) - 13

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... slyB slyA anmK
Gene Locus tag Description
slyB STM1445 outer membrane lipoprotein
slyA STM1444 transcriptional regulator SlyA
anmK STM1446 anhydro-N-acetylmuramic acid kinase