Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000b30
Genome
Salmonella enterica - NC_003197.1
TF
PhoP [UniProtKB:P0DM78, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CGCCATTGATAAACTGTTTAACA + [2928256, 2928278] 20661307 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) - 13

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... pipB2 virK
Gene Locus tag Description
pipB2 STM2780 secreted effector protein
virK STM2781 virulence protein