Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00000e50
Genome
Salmonella enterica - NC_003197.1
TF
CRP [UniProtKB:P0A2T8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAAAGTGACCTGACGCAATATTTGTCTTTTCTTGCTTATT + [1313344, 1313383] 9068635 Experimental technique details Beta-gal reporter assay - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 22

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... pepT potA potB STM1228 ycfD
Gene Locus tag Description
pepT STM1227 peptidase T
potA STM1226 putrescine/spermidine ABC transporter ATPase
potB STM1225 spermidine/putrescine ABC transporter membrane protein
STM1228 STM1228 hypothetical protein
ycfD STM1229 hypothetical protein