Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000011a0
Genome
Yersinia pestis - NC_003143.1
TF
CRP [UniProtKB:Q7CFV3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AATGTATGATCGAGATCACTTTT - [3660243, 3660265] 18710863 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 43

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... yfiA yfiO
Gene Locus tag Description
yfiA YPO3279 sigma 54 modulation protein
yfiO YPO3278 outer membrane protein assembly complex subunit YfiO