Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000011b0
Genome
Yersinia pestis - NC_003143.1
TF
CRP [UniProtKB:Q7CFV3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AATGTTTGATTGCCGTCACGTTT - [1831500, 1831522] 18710863 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 43

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ptsG YPO1607 holB tmk yceG
Gene Locus tag Description
ptsG YPO1608 PTS system glucose-specific transporter subunits IIBC
YPO1607 YPO1607 metallodependent hydrolase
holB YPO1606 DNA polymerase III subunit delta'
tmk YPO1605 thymidylate kinase
yceG YPO1604 hypothetical protein