Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000011d0
Genome
Yersinia pestis - NC_003143.1
TF
CRP [UniProtKB:Q7CFV3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GAGATGTGACTTTTATCACAACA + [4451198, 4451220] 18710863 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 43

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... YPO3953 gntM
Gene Locus tag Description
YPO3953 YPO3953 gluconokinase
gntM YPO3954 gluconate permease