Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00001230
Genome
Yersinia pestis - NC_003143.1
TF
CRP [UniProtKB:Q7CFV3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AGATTGTGACTTGTCTCTCAATT - [2415204, 2415226] 18710863 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 43

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... dadA YPO2145 YPO2148
Gene Locus tag Description
dadA YPO2147 D-amino acid dehydrogenase small subunit
YPO2145 YPO2145 SpoVR family protein
YPO2148 YPO2148 multidrug resistance protein