Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00001280
Genome
Yersinia pestis - NC_003143.1
TF
CRP [UniProtKB:Q7CFV3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AATATGTGCTGGATATAACAGTT + [417677, 417699] 18710863 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 43

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... YPO0400 YPO0399 YPO0398 YPO0401 YPO0402
Gene Locus tag Description
YPO0400 YPO0400 hypothetical protein
YPO0399 YPO0399 hypothetical protein
YPO0398 YPO0398 M48 peptidase family protein
YPO0401 YPO0401 transcriptional regulator
YPO0402 YPO0402 fructose-like phosphotransferase EIIB subunit 3