Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000012b0
Genome
Yersinia pestis - NC_003143.1
TF
CRP [UniProtKB:Q7CFV3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATTTTGTGACGTAGGTCACTGTA + [2847630, 2847652] 18710863 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 43

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... YPO2536 YPO2537
Gene Locus tag Description
YPO2536 YPO2536 D-isomer specific 2-hydroxyacid dehydrogenase family protein
YPO2537 YPO2537 LacI family transcriptional regulator