Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000012c0
Genome
Yersinia pestis - NC_003143.1
TF
CRP [UniProtKB:Q7CFV3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATTGTGTGAATCATGTCACATTG - [3124317, 3124339] 18710863 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 43

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... YPO2795 YPO2794 YPO2793 YPO2792 yapC
Gene Locus tag Description
YPO2795 YPO2795 hypothetical protein
YPO2794 YPO2794 hypothetical protein
YPO2793 YPO2793 hypothetical protein
YPO2792 YPO2792 hypothetical protein
yapC YPO2796 autotransporter protein