Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000014b0
Genome
Pseudomonas putida - NC_002947.3
TF
LexA [UniProtKB:P0A153, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GGGCTGGATATATTTTCAGTGT - [1286576, 1286597] 17933893 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) - 62

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... dinG PP_1124 PP_1126
Gene Locus tag Description
dinG PP_1125 ATP-dependent DNA helicase DinG
PP_1124 PP_1124 hypothetical protein
PP_1126 PP_1126 Beta-agarase